Journal: Journal of Biological Chemistry

Article Title: Transforming Growth Factor (TGF)-β-activated Kinase 1 Mimics and Mediates TGF-β-induced Stimulation of Type II Collagen Synthesis in Chondrocytes Independent of Col2a1 Transcription and Smad3 Signaling

doi: 10.1074/jbc.m500646200

Figure Lengend Snippet: FIG. 4. TAK1a mediates the stimulation of type II collagen synthesis by TGF- and BMP2 and exhibits TAB1-independent kinase activity. A, chondrocytes were infected 24 h after plating with dominant-negative TAK1 adenoviral vectors, Ad-pC-hTAK1a-K63A, and Ad-pC-hTAK1a-K63W. Seventy-two hours after initiating infec- tion, cells were treated for 24 h with 5 ng/ml TGF-1 (T) or 100 ng/ml BMP2 (B) in the presence of [3H]proline. Samples from triplicate wells were pooled before SDS-PAGE. B, for immune complex kinase assays, chondrocytes were infected with Ad-pC-hTAK1a (TK), kinase-negative (KN) Ad-pC-hTAK1a-KWSA, and the tandem vector (TK,TB) pCEA3- hTAB1(pC-hTAK1a). Forty-eight hours after beginning infection, cells were treated with TGF-1 (40 ng/ml; T) or IL-1 (40 ng/ml; IL) for 10 min prior to lysis, immunoprecipitation with TAK-ct antibody, and TAK1a immune complex kinase assay using bacterially expressed GST- MKK6 as substrate. Lysates were equally divided prior to immunopre- cipitation to permit direct kinase assays in the presence of [-32P]ATP (upper panels) or kinase assay after pretreatment with cold ATP (lower panels). The right panels are 7-fold shorter exposures of the last two lanes. C, Western blots (IB) demonstrating activation of endogenous TAK1 and TAB1 and their overexpressed counterparts. Chondrocytes were treated for 10 or 30 min with TGF-1 (5 ng/ml) or BMP2 (100 ng/ml) and lysed with SDS sample buffer at the same time as cells exposed to 48 h of adenoviral expression of TAK1a or coexpressed TAK1a and TAB1 (tandem construct). TAK-ct and TAB-m primary antibodies were used for detection. Long dashes, unmodified TAK1 or TAB1 bands; short dashes, activated/phosphorylated bands. Right panel, shorter exposures of lanes 5 and 6.

Article Snippet: Subsequently, cells were fed with the same medium, treated with recombinant human TGF- 1 or BMP2 (R&D Systems) for 24 h and then labeled in fresh medium with tritiated proline for 24 h. Labeling medium was 0.3% ITS /DMEM, 62.5 g/ml -aminoproprionitrile, 25 g/ml ascorbate, 40 Ci/ml [5-3H]proline (Amersham Biosciences), and growth factors.

Techniques: Activity Assay, Infection, Dominant Negative Mutation, SDS Page, Immune Complex Kinase Assay, Plasmid Preparation, Lysis, Immunoprecipitation, Kinase Assay, Western Blot, Activation Assay, Expressing, Construct

Journal: British Journal of Cancer

Article Title: The BMP pathway either enhances or inhibits the Wnt pathway depending on the SMAD4 and p53 status in CRC

doi: 10.1038/bjc.2014.560

Figure Lengend Snippet: Activation of BMP signalling differentially modulates Wnt signalling dependent on the SMAD4 and p53 status. ( A ) CRC cell lines HCT116, LS174T, HT-29, SW480, RKO and DLD-1 and the embryonic kidney cell line HEK-293 (used as non-cancer cell line) were transfected with WRE-luc and MRE-luc. The next day, the cells were transfected with either BMPR2 (to activate BMP signalling) or the empty control vector pcDNA4/TO. After 24 h, the cells were lysed and luciferase activity was measured. The control (pcDNA) condition was set to 1. ( B ) An overview of APC/ β -catenin, KRAS/BRAF, p53 and SMAD4 mutation status in the cell lines. ( C ) HCT116, HCT116 SMAD4−/−, HCT116 R248 (p53 mutated) and HCT116 p53−/− cells were transfected with WRE-luc and MRE-luc. The next day, the cells were transfected with either BMPR2 (to activate BMP signalling) or the empty control vector pcDNA4/TO. After 24 h, the cells were lysed and luciferase activity was measured. ( D ) DLD-1 (harbouring a p53 mutation) and DLD-1 SIL/+ (one WT copy p53) were transfected with WRE-luc/MRE-luc. The next day, the cells were treated with either 100 ng ml −1 BMP2 or the control vehicle (both diluted in medium with 0,5% FCS). After 24 h, the cells were lysed and luciferase activity was measured. ( E ) SMAD4 was stably knocked down in LS174T cell using lentiviral shRNA transduction. The empty shRNA SHC002 was used to create a control cell line. The cells were transfected with WRE-luc/MRE-luc. The next day the cells were treated with either 100 ng ml −1 BMP2 or the control vehicle (both diluted in medium with 1% FCS). After 24 h, the cells were lysed and luciferase activity was measured. (All the experiments were performed three times. Mean±s.e.m. is shown, * P <0.05, ** P <0.01, *** P <0.001)

Article Snippet: Stock solutions of recombinant human BMP2 ligands (R&D systems, Minneapolis, MN, USA) were prepared in phosphate-buffered saline (PBS) and subsequently dissolved in culture medium (100 ng ml −1 ) containing 0.5% FCS.

Techniques: Activation Assay, Transfection, Control, Plasmid Preparation, Luciferase, Activity Assay, Mutagenesis, Stable Transfection, shRNA, Transduction

Journal: Journal of Biological Chemistry

Article Title: Bone Morphogenetic Protein 2 Mediates Dentin Sialophosphoprotein Expression and Odontoblast Differentiation via NF-Y Signaling

doi: 10.1074/jbc.m709492200

Figure Lengend Snippet: FIGURE 1. Effect of BMP2 on DSPP expression in mouse preodontoblasts. A, quantitative RT-PCR analysis of DSPPmRNAexpressionfromMD10-F2cellstreatedwithorwithoutBMP2(100ng/ml)at12,24,48,and72h.Values were expressed as fold increase versus cells without BMP2 as 1.0-fold. * indicates significant differences between the BMP2-treatedand-untreatedcells(*,p0.05).B,qRT-PCRproductsfromoneofthreeexperimentswererunonto1.5% agarose gels and stained with ethidium bromide. M, DNA marker; Neg, negative control; Cyclo, cyclophilin serves as an internal control. Con and bmp2 lanes show MD10-F2 cells without or with BMP2 stimulation, respectively. C, DSPP protein expression in MD10-F2 cells in the presence or absence of BMP2. MD10-F2 cells treated with or without BMP2 were incubated with anti-DSP polyclonal antibody. Mouse IgG1 was used as a negative control. The samples were then incubated with the secondary antibody conjugated to Alexa Fluo 488 (Molecular Probes). Alexa Fluo 488stainingimageswereobtainedunderthesameparametersinanOlympuswidefieldmicroscopeandquantified by means of MetaMorph software. Bri and Fluo indicate bright and fluorescent fields, respectively.

Article Snippet: Immunohistochemistry—Mouse MD10-F2 cells were cultured on glass slides and treated with or without 100 ng/ml of recombinant BMP2 (R & D Systems Inc.) at different time points.

Techniques: Expressing, Quantitative RT-PCR, Staining, Marker, Negative Control, Control, Incubation, Software

Journal: Journal of Biological Chemistry

Article Title: Bone Morphogenetic Protein 2 Mediates Dentin Sialophosphoprotein Expression and Odontoblast Differentiation via NF-Y Signaling

doi: 10.1074/jbc.m709492200

Figure Lengend Snippet: FIGURE 2. The DSPP promoter contains a BMP2-response element. A, schematic representation of the constructs used in the luciferase (Luc) assay. B, BMP2 stimulates DSPP promoter activity. Transient MD10-F2 transfectants in the presence or absence of BMP2 (100 ng/ml) for 12 h were used to determine transcriptional activity of those chimeric constructs. The value obtained from the control group (pGL3 basic only) was taken as 1-fold, and fold increases were calculated by dividing the individual value by the control group value and plotted as a graph showing the mean S.E. from three independent experiments in triplicate. Significant differences comparing BMP2-treated groups with BMP2-untreated groups are shown with the following prob- ability levels: *, p 0.05; **, p 0.001.

Article Snippet: Immunohistochemistry—Mouse MD10-F2 cells were cultured on glass slides and treated with or without 100 ng/ml of recombinant BMP2 (R & D Systems Inc.) at different time points.

Techniques: Construct, Luciferase, Activity Assay, Control

Journal: Journal of Biological Chemistry

Article Title: Bone Morphogenetic Protein 2 Mediates Dentin Sialophosphoprotein Expression and Odontoblast Differentiation via NF-Y Signaling

doi: 10.1074/jbc.m709492200

Figure Lengend Snippet: FIGURE 3. NF-Y binding to the BMP2-response element in the mouse DSPP promoter. A, 32P-labeled double strand probe between nt 97 and 72 was incubated with MD10-F2 cell nuclear extracts in the presence or absence of 50- and 100-fold molar excesses of unlabeled competitor DNA described in Table 1. WT, wild type. B, mouse DSPP proximal promoter nucleotide sequences are shown from nt 100 to 66. Several potential transcription factor-binding sites are present in this element. C, comparison of mouse, rat, and human DNA sequences from 100 to 66 positions. Dots represent nucleotide identity. D, NF-Y antibody supershift assay. MD10-F2 cell nuclear extracts were preincubated with antibody to NF-Y subunits or serum, respectively, and then with 32P-labeled wild-type (lanes 1–9) or 32P-labeled NF-Y probes (lanes 10–18). E, NF-Y-binding site schematic in the mouse DSPP promoter. The black box shows the NF-Y- bindingbox.ThearrowsindicatespecificprimersforChIPassay.F,ChIPassay.ChIPanalysiswasperformedasdescribedunder“ExperimentalProcedures.”Lane 2 shows a negative control. Lane 3 shows the TFIIB antibody was bound to TFIIB-binding site in the GAPDH promoter region. The immunoprecipitated and purified DNA fragments as a template were amplified by GAPDH PCR primers. Lane 4 shows input DNA amplified by mouse DSPP primers. Lane 5 shows the DSPP target was effectively immunoprecipitated by the anti-NF-YB antibody.

Article Snippet: Immunohistochemistry—Mouse MD10-F2 cells were cultured on glass slides and treated with or without 100 ng/ml of recombinant BMP2 (R & D Systems Inc.) at different time points.

Techniques: Binding Assay, Labeling, Incubation, Comparison, Negative Control, Immunoprecipitation, Purification, Amplification

Journal: Journal of Biological Chemistry

Article Title: Bone Morphogenetic Protein 2 Mediates Dentin Sialophosphoprotein Expression and Odontoblast Differentiation via NF-Y Signaling

doi: 10.1074/jbc.m709492200

Figure Lengend Snippet: FIGURE 4. DSPP, BMP2, and NF-Y gene expression in tooth organs during development. A–L, in situ hybridization of mouse tooth developmental stages from E15 to PN1 with BMP2 (B, D, and F) and DSPP (H, J, and L) antisense probes. Hematoxylin was shown in A, C, E, G, I, and K. od, odontoblasts; am, ameloblasts; p, dental pulp cells; c, cartilage; eo, enamel organ; dp, dental papilla; e, enamel; d, dentin. Bar scale is 200 M. M, effect of BMP2 on ALP activity in MD10-F2 cells. After the cells were treated with BMP2 (100 ng/ml) or without BMP2 (con) for 3 and 6 days, ALP activity was determined as described under “Experimental Procedures.”DataweremeansS.E.ofthreewells,significantlydifferentfromthecontrolwithoutBMP2.*,p0.001.N,RT-PCRamplificationofthethreeNF-Y subunits were carried out. Ten l of PCR products were analyzed on 1.5% agarose gels. Amplification products of mouse -actin served as an internal control. M, 100-bp DNA ladder. Arrows indicate expected PCR products of the three NF-Y subunits, NF-YA, NF-YB, and NF-YC, and -actin genes. Con, negative control; 10-F2, MD10-F2; 2 wk, 10 wk, and 13 wk indicate mouse molars at aged 2, 10, and 13 weeks after birth, respectively.

Article Snippet: Immunohistochemistry—Mouse MD10-F2 cells were cultured on glass slides and treated with or without 100 ng/ml of recombinant BMP2 (R & D Systems Inc.) at different time points.

Techniques: Gene Expression, In Situ Hybridization, Activity Assay, Amplification, Control, Negative Control

Journal: Journal of Biological Chemistry

Article Title: Bone Morphogenetic Protein 2 Mediates Dentin Sialophosphoprotein Expression and Odontoblast Differentiation via NF-Y Signaling

doi: 10.1074/jbc.m709492200

Figure Lengend Snippet: FIGURE 5. Effect of BMP2 on NF-Y expression in MD10-F2 cells. A, qRT-PCR analysis of NF-Y subunit mRNA expression in MD10-F2 cells. Cells were grown in the presence or absence of BMP2 at the given time points. NF-Y mRNA expression in MD10-F2 cells in the absence of BMP2 served as a 1.0-fold increase. * indicates significant differences between the BMP2-treated and -untreated cells (p 0.05). B, qRT-PCR products from one of three experiments were run on 1.5% agarose gels and stained with ethidium bromide. M, DNA marker; Neg, negative control; Cyclo, cyclophilin served as an internal control. Con and bmp2 show MD10-F2 cells without or with BMP2 induction, respectively. C, MD10-F2 cells stimulated with or without BMP2 for the indi- cated times were subjected to ChIP with anti-NF-YB antibody. Immunoprecipitated and purified DNA frag- ments were subjected to PCR with primers covering the NF-Y-binding site of the mouse DSPP promoter.

Article Snippet: Immunohistochemistry—Mouse MD10-F2 cells were cultured on glass slides and treated with or without 100 ng/ml of recombinant BMP2 (R & D Systems Inc.) at different time points.

Techniques: Expressing, Quantitative RT-PCR, Staining, Marker, Negative Control, Control, Immunoprecipitation, Purification, Binding Assay

Journal: Journal of Biological Chemistry

Article Title: Bone Morphogenetic Protein 2 Mediates Dentin Sialophosphoprotein Expression and Odontoblast Differentiation via NF-Y Signaling

doi: 10.1074/jbc.m709492200

Figure Lengend Snippet: FIGURE 6. Inhibition of BMP 2 effect of NF-Y expression in MD10-F2 cells by cycloheximide. MD10-F2 cells were treated with BMP2 (100 ng/ml) in the presence or absence of CHX (10 g/ml) at the indicated time points. Protein expression of NF-YA, NF-YB, NF-YC, DSP, and -actin was detected by Western blot analysis as described under “Experimental Procedures.”

Article Snippet: Immunohistochemistry—Mouse MD10-F2 cells were cultured on glass slides and treated with or without 100 ng/ml of recombinant BMP2 (R & D Systems Inc.) at different time points.

Techniques: Inhibition, Expressing, Western Blot

Journal: Journal of Biological Chemistry

Article Title: Bone Morphogenetic Protein 2 Mediates Dentin Sialophosphoprotein Expression and Odontoblast Differentiation via NF-Y Signaling

doi: 10.1074/jbc.m709492200

Figure Lengend Snippet: FIGURE 7. NF-Y-binding site is important in BMP2-mediated DSPP promoter activity. A, illustration of wild-type and mutant DSPP promoter-luciferase reporter gene constructs. The diagram shows the relative positions and sequences of the NF-Y-binding site with mutated sequences shown in lowercase. B, effect of BMP2 on DSPP promoter activity. MD10-F2 cells were transfected with p97wt-luc, p97mut-luc, or empty vector (pGL3-basic only). pRL-TK (Renilla luciferase) co-transfection served as an internal control. These transfectants were treated or untreated with recombinant BMP2 (100 ng/ml) for 12 h before cell harvest. The value (ratio between firefly and Renilla luciferase) was compared with the control group (pGL3-basic only). The fold lucif- erase activity was determined by dividing the individual values by the control group value. The data are expressed as the mean S.E. from at least three separate experiments performed in triplicate. Significant differences comparing BMP2-treated cells with untreated cells are shown with following probability levels: **, p 0.01. C, effect of BMP antagonist Noggin on BMP2-mediated DSPP transcription. Transient transfection p97 analysis in the presence or absence of BMP2 (100 ng/ml) for 12 h in MD10-F2 cells is shown with the effects of Noggin at different doses. The results obtained from three separate transfections show the mean S.E. Significant differences compared with groups untreated with Noggin are shown with the following probability levels: *, p 0.05; **, p 0.001.

Article Snippet: Immunohistochemistry—Mouse MD10-F2 cells were cultured on glass slides and treated with or without 100 ng/ml of recombinant BMP2 (R & D Systems Inc.) at different time points.

Techniques: Binding Assay, Activity Assay, Mutagenesis, Luciferase, Construct, Transfection, Plasmid Preparation, Cotransfection, Control, Recombinant

Journal: Pharmaceuticals

Article Title: FOXO3-Activated circFGFBP1 Inhibits Extracellular Matrix Degradation and Nucleus Pulposus Cell Death via miR-9-5p/BMP2 Axis in Intervertebral Disc Degeneration In Vivo and In Vitro

doi: 10.3390/ph16030473

Figure Lengend Snippet: BMP2 is identified as a target of miR-9-5p. ( A ) BMP2 expression under IL-1β stimulation using qPCR. ( B ) The potential site of miR-9-5p located in BMP2 by starBase. ( C ) The relationship between miR-9-5p and BMP2 via dual luciferase reporter gene assay. ( D ) BMP2 expression by qPCR and Western blot. Data were estimated as mean ± SD. * p < 0.05, ** p < 0.01.

Article Snippet: The downregulation plasmid of BMP2 based on the short hairpin RNA (shRNA) sequence (sh-BMP2) and its negative control (sh-NC) were purchased from RiboBio (Guangzhou, China).

Techniques: Expressing, Luciferase, Reporter Gene Assay, Western Blot

Journal: Pharmaceuticals

Article Title: FOXO3-Activated circFGFBP1 Inhibits Extracellular Matrix Degradation and Nucleus Pulposus Cell Death via miR-9-5p/BMP2 Axis in Intervertebral Disc Degeneration In Vivo and In Vitro

doi: 10.3390/ph16030473

Figure Lengend Snippet: Knockdown of miR-9-5p suppresses apoptosis and ECM degradation by targeting BMP2 in NP cells. ( A ) MiR-9-5p expression by qPCR. ( B ) BMP2 expression by qPCR and Western blot. ( C ) Cell viability by CCK-8 assay. ( D ) Apoptosis in NP cells by flow cytometry. ( E , F ) Expressions of ECM proteins by Western blot ( E ) and immunofluorescence ( F ). Data were estimated as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The downregulation plasmid of BMP2 based on the short hairpin RNA (shRNA) sequence (sh-BMP2) and its negative control (sh-NC) were purchased from RiboBio (Guangzhou, China).

Techniques: Knockdown, Expressing, Western Blot, CCK-8 Assay, Flow Cytometry, Immunofluorescence

Journal: Pharmaceuticals

Article Title: FOXO3-Activated circFGFBP1 Inhibits Extracellular Matrix Degradation and Nucleus Pulposus Cell Death via miR-9-5p/BMP2 Axis in Intervertebral Disc Degeneration In Vivo and In Vitro

doi: 10.3390/ph16030473

Figure Lengend Snippet: Overexpression of circFGFBP1 alleviates the progression of IVDD in vivo. ( A ) CircFGFBP1 expression in NP tissues by qPCR. ( B ) Histopathological changes by H&E staining. ( C ) Apoptosis in NP tissues by TUNEL staining. ( D ) Expressions of ECM proteins in NP tissues by Western blot. ( E ) Expressions of BMP2 and MMP-13 in in NP tissues by immunohistochemistry. ( F ) Expression of miR-9-5p by qPCR. Data were estimated as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The downregulation plasmid of BMP2 based on the short hairpin RNA (shRNA) sequence (sh-BMP2) and its negative control (sh-NC) were purchased from RiboBio (Guangzhou, China).

Techniques: Over Expression, In Vivo, Expressing, Staining, TUNEL Assay, Western Blot, Immunohistochemistry

Journal: Pharmaceuticals

Article Title: FOXO3-Activated circFGFBP1 Inhibits Extracellular Matrix Degradation and Nucleus Pulposus Cell Death via miR-9-5p/BMP2 Axis in Intervertebral Disc Degeneration In Vivo and In Vitro

doi: 10.3390/ph16030473

Figure Lengend Snippet: The primer sequences used in this study for qPCR.

Article Snippet: The downregulation plasmid of BMP2 based on the short hairpin RNA (shRNA) sequence (sh-BMP2) and its negative control (sh-NC) were purchased from RiboBio (Guangzhou, China).

Techniques:

Journal: Pharmaceuticals

Article Title: FOXO3-Activated circFGFBP1 Inhibits Extracellular Matrix Degradation and Nucleus Pulposus Cell Death via miR-9-5p/BMP2 Axis in Intervertebral Disc Degeneration In Vivo and In Vitro

doi: 10.3390/ph16030473

Figure Lengend Snippet: The primary antibodies used in this study for Western blot.

Article Snippet: The downregulation plasmid of BMP2 based on the short hairpin RNA (shRNA) sequence (sh-BMP2) and its negative control (sh-NC) were purchased from RiboBio (Guangzhou, China).

Techniques: Western Blot

Journal: Tissue Engineering. Part A

Article Title: Vascular Endothelial Growth Factor Inhibits Bone Morphogenetic Protein 2 Expression in Rat Mesenchymal Stem Cells

doi: 10.1089/ten.tea.2009.0426

Figure Lengend Snippet: Treatment Groups for Cotransfection/Coculture Experiment

Article Snippet: The candidate genes and primers used for quantitative real-time PCR are listed in . table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Gene Catalog no. or primer/probe details Vascular endothelial growth factor A ( VEGFa ) Mm00437304_m1 Bone morphogenetic protein 2 ( BMP2 ) Mm01340178_m1 Human adenovirus C serotype 5 Hexon Gene ( Hexon ) HEXON LEFT: atggacaacgtcaacccatt HEXON RIGHT: ctccgtcaacccttaggtca OLIGO: 6FAM-cgagtggaacttcaggaagg Eukaryotic 18s rRNA (18s rRNA) Hs99999901_s1 RUNX-2 Mm00501584_m1 Open in a separate window Quantitative RT-Polymerase Chain Reaction Gene Expression Primer/Probe Information

Techniques: Cotransfection

Journal: Tissue Engineering. Part A

Article Title: Vascular Endothelial Growth Factor Inhibits Bone Morphogenetic Protein 2 Expression in Rat Mesenchymal Stem Cells

doi: 10.1089/ten.tea.2009.0426

Figure Lengend Snippet: Quantitative RT-Polymerase Chain Reaction Gene Expression Primer/Probe Information

Article Snippet: The candidate genes and primers used for quantitative real-time PCR are listed in . table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Gene Catalog no. or primer/probe details Vascular endothelial growth factor A ( VEGFa ) Mm00437304_m1 Bone morphogenetic protein 2 ( BMP2 ) Mm01340178_m1 Human adenovirus C serotype 5 Hexon Gene ( Hexon ) HEXON LEFT: atggacaacgtcaacccatt HEXON RIGHT: ctccgtcaacccttaggtca OLIGO: 6FAM-cgagtggaacttcaggaagg Eukaryotic 18s rRNA (18s rRNA) Hs99999901_s1 RUNX-2 Mm00501584_m1 Open in a separate window Quantitative RT-Polymerase Chain Reaction Gene Expression Primer/Probe Information

Techniques: Gene Expression

Journal: Tissue Engineering. Part A

Article Title: Vascular Endothelial Growth Factor Inhibits Bone Morphogenetic Protein 2 Expression in Rat Mesenchymal Stem Cells

doi: 10.1089/ten.tea.2009.0426

Figure Lengend Snippet: Adenoviral transfection without proliferative alterations or signs of toxicity. Adenoviral vectors carrying the gene for BMP2, VEGF, or LacZ were used to transfect bone marrow–derived rat MSCs. Combinations of the genes were introduced to the cells at a total MOI of 100 PFU/cell. (A) Relative quantities of adenovirus Hexon mRNA expression were then analyzed (n = 3/group) and normalized by concurrent analysis of ribosomal 18S RNA. Similar levels of adenovirus-specific Hexon mRNA expression suggest that the viral load and efficacy of transfection were similar in all groups. Values represent mean ± SD of replicates (n = 3). (B) Alterations in growth was assessed at various time-points using the 3-(4,5-diamethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) (MTS) assay and compared to nontransfected controls. The growth curves were similar in all groups, and at the final day of the assay, no significant difference in optical density (proportional to cell number) was found between the groups. Labels in the graph represent the introduced genes and the corresponding viral MOI. Values represent mean ± SD of replicates (n = 5/group). BMP2, bone morphogenetic protein 2; VEGF, vascular endothelial growth factor; MOI, multiplicity of infection; PFU, plaque forming units; SD, standard deviation; MSCs, mesenchymal stem cells.

Article Snippet: The candidate genes and primers used for quantitative real-time PCR are listed in . table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Gene Catalog no. or primer/probe details Vascular endothelial growth factor A ( VEGFa ) Mm00437304_m1 Bone morphogenetic protein 2 ( BMP2 ) Mm01340178_m1 Human adenovirus C serotype 5 Hexon Gene ( Hexon ) HEXON LEFT: atggacaacgtcaacccatt HEXON RIGHT: ctccgtcaacccttaggtca OLIGO: 6FAM-cgagtggaacttcaggaagg Eukaryotic 18s rRNA (18s rRNA) Hs99999901_s1 RUNX-2 Mm00501584_m1 Open in a separate window Quantitative RT-Polymerase Chain Reaction Gene Expression Primer/Probe Information

Techniques: Transfection, Derivative Assay, Expressing, MTS Assay, Infection, Standard Deviation

Journal: Tissue Engineering. Part A

Article Title: Vascular Endothelial Growth Factor Inhibits Bone Morphogenetic Protein 2 Expression in Rat Mesenchymal Stem Cells

doi: 10.1089/ten.tea.2009.0426

Figure Lengend Snippet: Cotransfection of AdV-VEGF decreases BMP2 expression. Adenoviral vectors carrying the gene for BMP2, VEGF, or LacZ were used to transfect bone marrow–derived rat MSCs. Combinations of the genes were introduced to the cells at a total MOI of 100 PFU/cell. (A) When BMP2 was coexpressed with LacZ in various ratios, while keeping the total viral load constant, the mRNA expression varied according to the AdV-BMP2 MOI. When the same ratios were applied to the AdV-BMP2 and AdV-VEGF cotransfection, however, the BMP2 expression was drastically reduced, demonstrating an exponential distribution that seemed correlated to the AdV- BMP2:VEGF ratio rather than the AdV-BMP2 MOI alone. One group was plated as a coculture composed of cells, separately transfected with AdV-BMP2 and AdV-VEGF. The total number of cells as well as the total viral load and average AdV-BMP2 vector per cell was equal to the groups dually transfected with BMP2 (MOI 50) + VEGF (MOI 50) or BMP2 (MOI 50) + LacZ (MOI 50). The levels of BMP2 were approximately three times higher in cultures composed of separately transfected cells compared to cells dually transfected with AdV-BMP2 and AdV-VEGF. Separately transfected but cocultured cells expressed, however, less BMP2 compared to cells dually transfected with AdV-BMP2 and AdV-LacZ. (B) When the levels of BMP2 and VEGF were measured in the cell medium through real time PCR, the general patterns corresponded to the ELISA results and demonstrated that the phenomenon occurs at the mRNA level. (C, D) The expression of VEGF correlated to the AdV-VEGF MOI, relatively independent of any AdV-BMP2 or AdV-LacZ cotransfection, when evaluated with ELISA and rtPCR. Relative quantities of RNA were obtained by normalization against ribosomal 18S RNA as well as viral-specific Hexon RNA to weigh in any variations in viral transfection between groups. Labels in the graph represent the introduced genes and the corresponding viral MOI. Values represent mean ± SD of replicates (n = 3). ELISA, enzyme-linked immunosorbent assay; PCR, polymerase chain reaction.

Article Snippet: The candidate genes and primers used for quantitative real-time PCR are listed in . table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Gene Catalog no. or primer/probe details Vascular endothelial growth factor A ( VEGFa ) Mm00437304_m1 Bone morphogenetic protein 2 ( BMP2 ) Mm01340178_m1 Human adenovirus C serotype 5 Hexon Gene ( Hexon ) HEXON LEFT: atggacaacgtcaacccatt HEXON RIGHT: ctccgtcaacccttaggtca OLIGO: 6FAM-cgagtggaacttcaggaagg Eukaryotic 18s rRNA (18s rRNA) Hs99999901_s1 RUNX-2 Mm00501584_m1 Open in a separate window Quantitative RT-Polymerase Chain Reaction Gene Expression Primer/Probe Information

Techniques: Cotransfection, Expressing, Derivative Assay, Transfection, Plasmid Preparation, Real-time Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

Journal: Tissue Engineering. Part A

Article Title: Vascular Endothelial Growth Factor Inhibits Bone Morphogenetic Protein 2 Expression in Rat Mesenchymal Stem Cells

doi: 10.1089/ten.tea.2009.0426

Figure Lengend Snippet: Adenoviral-mediated BMP2 overexpression and MSC differentiation can be suppressed by exogenous VEGF. (A) Bone marrow–derived rat MSCs transfected with Adv-BMP2 at an MOI of 100 PFU/cell were exposed to the medium supplemented with 10 or 50 ng/mL recombinant VEGF protein. After 48 h, cultures were analyzed with ELISA and showed a dose-dependant decrease in BMP2 production dependent on the VEGF concentration. BMP2 production decreased fivefold when VEGF was supplemented to a concentration of 50 ng/mL, indicating that exogenous VEGF is a potent inhibitor of BMP2 expression in MSCs. (B) MSCs were cultured in the differentiation medium and assessed for expression of early bone differentiation marker RUNX-2. At 12 h RUNX-2 expression was markedly reduced in cells exposed to recombinant VEGF. (C) While positive staining for calcium deposits was found in cell cultures grown for 21 days in the differentiation medium without rhVEGF (left), little signs of bone formation were present in cultures grown under the same conditions but with VEGF-supplement (right).

Article Snippet: The candidate genes and primers used for quantitative real-time PCR are listed in . table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Gene Catalog no. or primer/probe details Vascular endothelial growth factor A ( VEGFa ) Mm00437304_m1 Bone morphogenetic protein 2 ( BMP2 ) Mm01340178_m1 Human adenovirus C serotype 5 Hexon Gene ( Hexon ) HEXON LEFT: atggacaacgtcaacccatt HEXON RIGHT: ctccgtcaacccttaggtca OLIGO: 6FAM-cgagtggaacttcaggaagg Eukaryotic 18s rRNA (18s rRNA) Hs99999901_s1 RUNX-2 Mm00501584_m1 Open in a separate window Quantitative RT-Polymerase Chain Reaction Gene Expression Primer/Probe Information

Techniques: Over Expression, Derivative Assay, Transfection, Recombinant, Enzyme-linked Immunosorbent Assay, Concentration Assay, Expressing, Cell Culture, Marker, Staining

Journal: Tissue Engineering. Part A

Article Title: Vascular Endothelial Growth Factor Inhibits Bone Morphogenetic Protein 2 Expression in Rat Mesenchymal Stem Cells

doi: 10.1089/ten.tea.2009.0426

Figure Lengend Snippet: BMP2 inhibition occurs at the transcriptional level. To determine if the inhibition of BMP2 by VEGF occurred as a result of changes in transcription or translation, these processes were inhibited using RNA-polymerase II inhibitor actinomycin-D or the protein synthesis inhibitor cycloheximide. (A) Rat MSCs were transfected with AdV-BMP2 at an MOI of 50 PFU/cell and exposed to the medium containing 5 ng/mL actinomycin-D, with or without 10 ng/mL VEGF. A time course of BMP2 transcript expression demonstrated a similar rate of BMP2 transcript degradation (slope −0.4872 ± 0.03695 vs. −0.5059 ± 0.1170), implying that VEGF reduces BMP2 expression by a method other than transcriptional degradation. (B) MSCs were transfected with the combination of either AdV-BMP2 and AdV-VEGF or AdV-BMP2 and AdV-LacZ at a 1:1 ratio and then exposed to the medium containing 10 ng/mL cycloheximide. Six hours after cycloheximide supplementation analysis with rtPCR showed no increase in BMP2 expression, indicating that protein translation is not necessary for inhibition of BMP2 expression by VEGF. Values represent mean ± SD of replicates (n = 3).

Article Snippet: The candidate genes and primers used for quantitative real-time PCR are listed in . table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Gene Catalog no. or primer/probe details Vascular endothelial growth factor A ( VEGFa ) Mm00437304_m1 Bone morphogenetic protein 2 ( BMP2 ) Mm01340178_m1 Human adenovirus C serotype 5 Hexon Gene ( Hexon ) HEXON LEFT: atggacaacgtcaacccatt HEXON RIGHT: ctccgtcaacccttaggtca OLIGO: 6FAM-cgagtggaacttcaggaagg Eukaryotic 18s rRNA (18s rRNA) Hs99999901_s1 RUNX-2 Mm00501584_m1 Open in a separate window Quantitative RT-Polymerase Chain Reaction Gene Expression Primer/Probe Information

Techniques: Inhibition, Transfection, Expressing, Reverse Transcription Polymerase Chain Reaction

Journal: Tissue Engineering. Part A

Article Title: Vascular Endothelial Growth Factor Inhibits Bone Morphogenetic Protein 2 Expression in Rat Mesenchymal Stem Cells

doi: 10.1089/ten.tea.2009.0426

Figure Lengend Snippet: VEGF-mediated BMP2 inhibition impairs bone formation in vivo. Bone marrow–derived MSCs from green fluorescent transgenic rats were seeded on collagen scaffolds and transfected with adenoviral vectors carrying the gene for BMP2, VEGF, or LacZ. Combinations of the genes were introduced to the cells at a 1:1 ratio with a total MOI of 100 PFU/cell. Constructs were then implanted in the groin of syngeneic green fluorescent protein–negative rats, and the superficial epigastric artery and vein were incorporated into the implant. While constructs transfected with AdV-BMP2 and AdV-VEGF formed little or no bone (A), implants transfected with AdV-BMP2 and AdV-LacZ were completely or in part replaced by bone (arrow) (B) as shown in the microcomputed tomography images. Decalcified sections of the AdV-BMP2:LacZ implants showed formation of cancellous bone surrounding the epigastric pedicle (arrow) (C). Donor cells expressing green fluorescent protein could be found within the osseous tissue (D). Color images available online at www.liebertonline.com/ten.

Article Snippet: The candidate genes and primers used for quantitative real-time PCR are listed in . table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Gene Catalog no. or primer/probe details Vascular endothelial growth factor A ( VEGFa ) Mm00437304_m1 Bone morphogenetic protein 2 ( BMP2 ) Mm01340178_m1 Human adenovirus C serotype 5 Hexon Gene ( Hexon ) HEXON LEFT: atggacaacgtcaacccatt HEXON RIGHT: ctccgtcaacccttaggtca OLIGO: 6FAM-cgagtggaacttcaggaagg Eukaryotic 18s rRNA (18s rRNA) Hs99999901_s1 RUNX-2 Mm00501584_m1 Open in a separate window Quantitative RT-Polymerase Chain Reaction Gene Expression Primer/Probe Information

Techniques: Inhibition, In Vivo, Derivative Assay, Transgenic Assay, Transfection, Construct, Tomography, Expressing